Review: Next Generation Sequencing and Its Applications in Forensic Genetics

/in ,

Emily C. Lennert

Category: Biology

Keywords: DNA, next generation sequencing, genetics, capillary electrophoresis, alleles, genetics, sequencing

Article to be reviewed:

  1. Walnycky, D.; Baggili, I.; Marrington, A.; Moore, J.; Breitinger, F. “Next generation sequencing and its applications in forensic genetics.” Digital Investigation. 2015, 14.

Additional references:

  1. STR Analysis. http://nij.gov/journals/267/pages/extending-str.aspx (accessed August 29, 2016)
  2. DNA Evidence: Basics of Analyzing. http://nij.gov/topics/forensics/evidence/dna/basics/Pages/analyzing.aspx (accessed August 29, 2016)

Disclaimer: The opinions expressed in this review are an interpretation of the research presented in the article. These opinions are those of the summation author and do not necessarily represent the position of the University of Central Florida or of the authors of the original article.

Summary:

DNA is a popular and often sought after form of evidence. DNA sequencing was introduced into the field of forensic genetic in the late 1980s and early 1990s.1 The most common type of modern DNA sequencing is the analysis of short tandem repeat (STR) alleles.2 DNA contains specific areas of short repeating sequences (i.e. GGTATCATCATCATCATCATCCTAG), which repeat a varying number of times, called STRs.2 STRs vary between individuals, and, for forensic comparison purposes, STRs are analyzed at 13 different loci, or locations, on the DNA strand.2 At each location, there are two STR alleles, one of which comes from your mother and the other from your father. Based on the lengths of these alleles, an unknown sample can be matched to a known sample by matching the alleles at each location. The probability of two individuals having a perfect match of alleles at all 13 loci are roughly 1 in 1 billion, unless the individuals are identical twins, making STR sequencing a reliable method for individualization.2 These 13 loci were chosen by the FBI to serve as the CODIS standard STR markers used to compare samples.3

DNA sequencing can be broken down into four major steps: 1) removal, or isolation, of DNA from a piece of evidence; 2) DNA processing prepares the DNA for sequencing by multiplying the DNA STRs to increase the amount of sample to a minimum threshold that is necessary for sequencing; 3) DNA sequencing, which may be considered the testing or profiling phase; 4) DNA result comparison and interpretation.3

In many forensic cases, the amount of DNA recovered is small. For DNA sequencing to proceed successfully, identical copies of the DNA are made by a process called polymerase chain reaction (PCR), which will allow for amplification of selected regions of DNA.1 DNA regions may be selected through the use of probes.1 After the DNA has been copied through the PCR process, the processing step can be considered complete.

According to the National Institute of Justice (NIJ), capillary electrophoresis (CE) is the current common method of separation used in DNA sequencing. CE uses a gel and electric current to separate DNA fragments. The result is a gel with visible bands. The bands allow for comparison and matching of an unknown DNA sample (e.g. a crime scene sample) to a known sample (e.g. a sample from a potential suspect). (See figure 1 for a simplified example.)

While CE is a current “gold standard” technique for STR sequencing, Next Generation Sequencing (NGS) allows for simultaneous sequencing on a larger scale, and is also referred to as “massively parallel sequencing.”1 With CE-based sequencing techniques, each STR fragment is sequenced individually. After sequencing the first fragment, the process will move on to the second fragment and so on. With NGS, multiple CE runs may be combined into a single NGS run, allowing thousands of STR fragments to be sequenced simultaneously. PCR is still used to amplify the DNA STR fragments to a minimum threshold amount in preparation for NGS sequencing. One main difference between the CE and NGS processes is the interpretation method of the output data. In CE analysis, the STR fragment lengths are detected and measured for subsequent known to unknown comparisons (Figure 1). However, in NGS analysis, the user can identify each individual base pair in the STR fragment and make that comparison between the known and unknown samples (Figure 2).

seq2

NGS has been shown, in some studies, to have improved detection of STR alleles compared to CE.1 The review article discusses a study in which CE was used to determine which pair of alleles are present in gene loci, i.e. genotypes. The study found that 30% of homozygous (same) genotypes determined by CE were actually heterozygous (different) when determined by NGS.1 This means that CE classified the two alleles as being the same (i.e. AA) but when analyzed by NGS it was determined that these two alleles were actually different (i.e. AB). The review article also noted an instance in which a mixture of DNA was present. The target DNA was a minor contributor, accounting for 1:100 and 1:50 in two different samples, respectively. The authors were able to distinguish the minor contributor using NGS because they were able to read the individual base pairs and see the difference between the major and the minor DNA contributors. However, this was not feasible with the current CE process because the minor contributor was too low to be distinguished from the sample. The review article concludes that PCR combined with NGS is currently one of the most promising technologies for DNA sequencing with a potential for less error.

Scientific Highlights:

  • DNA analysis relies on sequencing STRs at 13 distinct loci.
  • PCR is used to amplify the amount of DNA in a sample to allow for sequencing.
  • CE is a current “gold standard”.
  • NGS may provide more accurate results than CE.
  • NGS may successfully distinguish individual DNA samples within mixtures.

Relevance: Next Generation Sequencing may provide a more accurate method for DNA sequencing that will strengthen DNA evidence.

Potential conclusions:

  • Next Generation Sequencing may provide more robust DNA sequencing than currently used methods such as capillary electrophoresis.